Chapter 6: Molecular Basis of Inheritance Class 12 Biology NCERT Solutions
Strengthen your understanding of DNA, RNA, replication, and gene expression through Chapter 6 NCERT Solutions. Download free PDFs and revise all topics. Scroll down for complete, step-by-step solutions.
To Help You Excel: NCERT Solutions for Class 12 Biology Chapter 6 – Molecular Basis of Inheritance
Our expert-prepared NCERT Solutions for Chapter 6 provide complete answers to all Intext and Exercise questions with accurate explanations, clear diagrams, and step-by-step reasoning. These solutions are designed to make challenging concepts like genetic code and operons easy to understand and remember.
What You Will Learn in Chapter 6 – Molecular Basis of Inheritance
This chapter builds the foundation of molecular biology by explaining how genetic material is stored, copied, and expressed in living organisms.
Key Topics Covered:
1. DNA – The Genetic Material
– Structure of DNA (Watson and Crick model)
– Chargaff’s rule and base pairing
– Proof that DNA is the genetic material (Hershey-Chase experiment)
2. DNA Replication
– Semi-conservative replication (Meselson and Stahl experiment)
– Role of enzymes: helicase, DNA polymerase, ligase
– Leading and lagging strand synthesis
3. RNA and Its Types
– Structure and function of mRNA, tRNA, rRNA
– Differences between DNA and RNA
– Roles in protein synthesis
4. Transcription and Genetic Code
– Process of transcription in prokaryotes and eukaryotes
– Triplet codons and features of the genetic code
– Start and stop codons
5. Translation and Protein Synthesis
– Steps: initiation, elongation, termination
– Role of ribosomes and tRNA
– Post-translational modifications
6. Regulation of Gene Expression
– Lac operon model in E. coli
– Inducible vs repressible systems
– Gene regulation in prokaryotes vs eukaryotes
7. Human Genome Project and DNA Fingerprinting
– Goals, methods, and applications of HGP
– VNTRs and the technique of DNA fingerprinting
– Importance in forensics and paternity testing
Why Use Our NCERT Solutions for Chapter 6?
Molecular biology can seem overwhelming with its technical terminology and complex pathways. Our solutions simplify each topic using clear language, well-labeled diagrams, and logically structured answers to help you grasp the content thoroughly.
Highlights of Our Solutions:
– Complete solutions for all NCERT Intext and Exercise questions
– Diagrams of DNA, replication fork, lac operon, and transcription units
– Tables and flowcharts for processes like replication and transcription
– Accurate answers suitable for board and NEET-level preparation
– Important definitions and keywords highlighted
NCERT Solutions for Chapter 6 – Molecular Basis of Inheritance
Intext Questions:
– Concept checks after each section with clear, concise answers
– Structural differences between DNA and RNA
– Significance of experiments proving DNA as genetic material
Exercise Questions (Q.1 to Q.14):
– Detailed answers on replication, transcription, and translation
– Explanations of lac operon and gene regulation
– Human Genome Project objectives and methodology
– Applications of DNA fingerprinting
Download Chapter 6 Solutions PDF – Molecular Basis of Inheritance
Get offline access to all NCERT solutions with our free downloadable PDF. Ideal for quick reference and last-minute board or NEET revision.
What’s Inside the PDF:
– Neatly formatted solutions with diagrams
– Step-by-step breakdowns of complex processes
– Complete coverage of NCERT textbook content
Recommended Preparation Tips:
– Practice drawing DNA structure, lac operon, and replication fork
– Memorize enzyme roles in replication and transcription
– Use tables to compare DNA vs RNA and transcription vs translation
– Understand genetic code logic and codon meanings
– Revise applications of DNA fingerprinting with real-life examples
Additional Study Resources:
– Class 12 Biology Notes – Chapter 6
– NCERT Exemplar Solutions – Molecular Basis of Inheritance
– Practice MCQs for NEET and CBSE
– Flowcharts summarizing key molecular processes
– Human Genome Project summary sheets
Master Molecular Biology with Confidence
Chapter 6 helps you understand how life’s blueprint is stored, read, and translated into functional proteins. With our comprehensive NCERT solutions and visual aids, you’ll gain a strong grip on the molecular basis of inheritance and be fully prepared for both academic and competitive success.
NCERT Solutions for Class 12 Biology Chapter 6 – Molecular Basis of Inheritance
Question 1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:
| Nitrogenous Bases | Nucleosides |
|---|---|
| Adenine, Uracil, Cytosine, Thymine | Cytidine, Guanosine |
Question 2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer: Cytosine = 20%, Guanine = 20%, remaining 60% is Adenine + Thymine. Thus, Adenine = 30%.
Question 3. If the sequence of one strand of DNA is written as 5′–ATGCATGCATGCATGCATGCATGCATGC–3′, write down the sequence of complementary strand in 5′ → 3′ direction.
Answer: Complementary strand: 5′–GCATGCATGCATGCATGCATGCATGCAT–3′
Question 4. If the sequence of the coding strand in a transcription unit is written as 5′–ATGCATGCATGCATGCATGCATGCATGC–3′, write down the sequence of mRNA.
Answer: mRNA sequence: 5′–AUGCAUGCAUGCAUGCAUGCAUGCAUGC–3′
Question 5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Answer: The double-stranded and complementary nature of DNA allowed Watson and Crick to propose that each strand serves as a template during replication, leading to semi-conservative replication where each daughter DNA contains one parental and one new strand.
Question 6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
- DNA-dependent DNA polymerase
- DNA-dependent RNA polymerase
- RNA-dependent DNA polymerase (reverse transcriptase)
- RNA-dependent RNA polymerase
Question 7. How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer: They labelled DNA with radioactive phosphorus-32 and protein with sulfur-35 in bacteriophages. Only radioactive DNA entered E. coli cells during infection, proving DNA is the genetic material.
Question 8. Differentiate between the following:
| Feature | Repetitive DNA | Satellite DNA |
|---|---|---|
| Definition | DNA sequences repeated many times | Highly repetitive DNA forming distinct bands |
| Feature | mRNA | tRNA |
|---|---|---|
| Function | Carries genetic information for protein synthesis | Transfers specific amino acids to ribosomes |
| Feature | Template Strand | Coding Strand |
|---|---|---|
| Role | Serves as template for RNA synthesis | Has sequence identical to RNA (except T replaced by U) |
Question 9. List two essential roles of ribosome during translation.
Answer:
- The small subunit binds to the mRNA and ensures correct base pairing.
- The large subunit catalyzes peptide bond formation through peptidyl transferase activity.
Question 10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?
Answer: As lactose is metabolised into glucose and galactose, the inducer (lactose) concentration decreases, reactivating the repressor protein and thus shutting down the lac operon.
Question 11. Explain (in one or two lines) the function of the following:
- (a) Promoter: Site where RNA polymerase binds to initiate transcription.
- (b) tRNA: Carries amino acids to the ribosome during protein synthesis.
- (c) Exons: Coding sequences expressed in the mature mRNA and translated into proteins.
Question 12. Why is the Human Genome Project called a mega project?
Answer: It involved massive international collaboration to sequence and map the entire human genome consisting of over 3 billion base pairs, requiring huge financial, computational, and human resources.
Question 13. What is DNA fingerprinting? Mention its application.
Answer: DNA fingerprinting is a technique for identifying individuals based on unique DNA patterns, especially using VNTRs (Variable Number Tandem Repeats).
Applications:
- Solving paternity disputes
- Criminal identification
- Detecting hereditary diseases
- Tracing ancestral lineages
Question 14. Briefly describe the following:
- (a) Transcription: Process of synthesizing RNA from a DNA template.
- (b) Polymorphism: Genetic variation at a particular locus within a population.
- (c) Translation: Synthesis of proteins using the information on mRNA, aided by tRNA and ribosomes.
- (d) Bioinformatics: Application of computational tools to store, retrieve, and analyze biological data, especially genetic data.